STEWART LABORATORY

 

---

 

 

 

       CONSTRUCTION OF LONG TERM RNAi CONSTRUCTS

 

This protocol allows you to order your oligos and then clone them into pLKO.1 and pMKO.1  (These replace Lentihair and Retrohair.  In addition, the cloning strategy
has changed from that reported in the original paper)

 

 

 

 

This upper case sequence is the 3’ end of the hU6 promoter from -68 to +1

 

 

CATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAA
AGGACGAAACACCGGtCCgcaggtatgcacgcgtgaattcgtcgac

 

      

 

 

 

 

 

 

                                                                                                         VpaK11AI

                                                                                      Sau96I

                                                                                      FmuI

                                                                                      AvaII           SelI

                                                                                     RsrII            BstUI      SalI

                                                                                    HpaII            MluI   Tsp509I

                                                                                   BsrFI             AflIII                                               
             HincII

 

                          MaeIII                                                   BsaWI   BspMI   Cac8I   EcoRI

             TaqI

              NdeI     Bst4CI             TaqI      CviJI                          AgeI  AciI     CviRI    ApoI  AccI

              |        |  |               |         |                              ||||  | |      || ||    ||    ||   

**TATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGtCCgcaggtatgcacgcgtgaattcg****
*  105  

 

 

****ACGAATGGCATTGAACTTTCATAAAGCTAAAGAACCGAAATATATAGAACACCTTTCCTGCTTTGTGGCCaGGcgtccatacgtgcgcacttaagcagct
*|        |  |      •        |•        |•         •         •         ||||  | | •    || ||•   ||    ||   

              1        10                 29        39                             70    76       85       94    100  

                          13                                                       70      78      86      94     101  

                                                                                   70                88          100  

                                                                                    71               88     95   

                                                                                     72               89         100  

                                                                                      73              89   

                                                                                      73   

                                                                                      73   

                                                                                      73   

                                73

 

 

 

 

 

 

 

 

ORDER THE OLIGOS
(58mer for sense and antisense oligos)

 

Ø      The first 21 bases in bold are the sequence for your target gene running 5’ to 3’

 

Ø      The second 21 bases should be the complementary sequence to the first 21

 

Ø      The AS oligo is the anti-sense to the S oligo, but remember, there are overhangs that facilitate cloning so DON’T change the ends, just insert your sequence where
indicated. 

 

The orientation is critical so don’t change things (unless you are purposely changing the cloning strategy!)

 

 

 

TERMINATION SIGNAL

 

Ø      The sequence TTT represents a termination signal for Pol3, so DO NOT put more than 3 T’s in your stem sequence!

 

 

 

BLAST YOUR SEQUENCES

 

 

Ø      Blast both the sense and anti-sense sequences to minimize the chance of generating off-target effects.  The latest dogma (as of 12/03) suggests that if you have less
than 9 contiguous nucleotides in common between you intended target and a related sequence you will not generate off-target effects.  Also, if there is identity between two closely related sequences, it is better to be in the 5’ region of the anti-sense sequence than the sense strand

 

 

 

SYNTHESIZING OLIGONUCLEOTIDES

 

Ø      Forward oligo:

 

§     5’ CCGG---21 bp Sense---CTCGAG---21 bp Antisense---TTTTTG3’

 

 

Ø      Reverse oligo:

 

§     5’ AATTCAAAAA---21 bp Sense---CTCGAG---21 bp Antisense---3’

 

 

ANNEAL OLIGOS

 

Ø      Re-suspend oligos in ddH20 (1 µg/mL):

 

§         5 µL of S oligo

 

§         5 µL of AS oligo

 

§         5 µL of 10x NEB buffer 2

 

§         35 µL ddH20

 

Ø      Incubate 4 min at 95°C

 

Ø      Incubate 10 min at 70°C in a 1000 mL beaker and allow the water in the beaker to cool to RT  (this will take a couple of hours, but it is important that you
do this slowly!)

 

 

LIGATE

 

Ø      Ligate into prepared vector (digested with Age1 and EcoR1).  I use the Roche rapid ligation kit:

 

§         Mix:

 

·        1 µL of the prepared oligo

 

·        1 µL of prepared vector

 

·        2 µL 5x DNA dilution buffer

 

·        6 µl ddH20

 

·        10 µL 2x ligation buffer

 

·        1 µL ligase

 

 

§         Incubate at RT for 2-15 hrs

 

§         Transform bacteria (when using the retroviral vector BE SURE to use RecA minus strains or you will get many recombinants.  We typically use DH5α,
XL1-Blue, or XL10-Gold)

 

 

SCREEN FOR INSERTS

 

I use a couple of different methods depending on my background levels.  Note:  some of the time the background plate shows more colonies than the plate with the insert.
This doesn’t mean the cloning didn’t work, it more often means that the concentration of the hairpin was too high and therefore, inhibitory to the ligation reaction (especially
if using the Rapid Ligation Kit from Roche).  I still screen these and usually get a few positives

 

         

1.      The most straightforward approach is to digest with MluI and BamHI.  If you get an insert you will get a linear band (only BamHI will cut).  The parental should be cut
twice and give you a band around 750bp and the rest of the vector

 

2.      PCR screening can make it easy to screen through large numbers of clones without the hassle of doing a lot of minipreps:

 

§         Place 100µL of LB + 100 µg/mL AMP in appropriate number of wells in a 96 well plate

 

§         Touch a toothpick to the colony and place into well (we also make a corresponding plate with each colony to expedite subsequent amplification)

 

§         Grow 1-4 hrs

 

§         Set up 50 µL PCR reaction

 

·        Mix:

 

¨      5 µL culture mix

 

¨      5 µL 10x Taq buffer

 

¨      0.5 µL dNTPs

 

¨      0.5 µL 5’ U6 primer (this the human U6)

 

¨      0.5 µL anti-sense oligo that you used to first make the hairpin ( see ORDERING OLIGOS above)

 

·        PCR program:

 

1 cycle

 

¨      94°C for 5 min
( important because this “blows apart” the bacteria and gives the enzyme access to the DNA)

 

 

30 cycles

 

¨      94°C for 30 min

¨      52°C for 45 min

¨      72°C for 30 min

 

 

 

§         Run a 2% gel and be sure to run a positive and negative control

 

·        Positive control:  dilute 100 ng of vector into 100 µL LB-AMP

 

·        Negative control:  LB-AMP alone

 

§         Run 100bp ladder

 

§         Use a dye that does not contain bromophenol blue (it will obscure the band that you are looking for)

 

§         We get our best results by running the gel in the absence of ethidium bromide.  After the run, we stain with 0.5 µg/mL ethidium bromide for 10 min
followed by a 15 min de-stain in running buffer

 

 

3.      Alternatively, you can digest with Nde1 and Mlu1 and look for the loss of an approximately 230bp band.  You will need to run a 2% gel to see this.
If your insert goes in you should only see 1 large (7.2 kb) band

 

4.      Another approach is to cut with Nde1 to EcoR1 and run on a 2% gel.  Look for a very subtle shift if you have the insert

 

 

 

 

If you chose to use Lentihair and/or Retrohair the cloning is as follows:

 

1.      Order the oligos:

 

§         Oligo 1-S:

 

 

(21 bases)TTCAAGAGA(21 bases)TTTTTG

 

 

 

§         Oligo 2-AS:

 

 

AATTCAAAAA(21 bases)TCTCTTGAA(21 bases)

 

 

 

 

2.      Once hybridized this must be ligated into a prepared vector (remember that you must chew back the Apa1 site which is a 3’ overhang)

 

 

 

 

 

 

Sequencing of hairpins in pLKO.1:

 

1.      Use the following primner:

 


5'-CAA GGC TGT TAG AGA GAT AAT TGGA-3'