STEWART LABORATORY

 

---

 

TRAP ASSAY

 

 

PREPARE LYSATE

 

      Lyse cells for 20-30 min on ice in CHAPS lysis buffer

 

      Spin cells at 4C for 20 min

 

      Save supernatant in a new RNase-free tube

 

      Quantify protein concentration using the BioRad kit. Be sure to have appropriate blanks and concentration controls

 

      Dilute a small portion of the sample to 50 ng/μL. Return the undiluted sample to -70C for future use

 

      Take one quarter of the diluted sample and boil for 5 min and crash on ice. This will serve as your heat inactivated control

 

 

END LABEL TS OLIGO

(this makes enough oligo for 10 reactions):

 

      Mix:

 

         2.5 μL γ-32P-ATP (3000 Ci/mmol)

 

         2 μL 10X buffer

 

         5.2 μL TS primer

 

         9.8 μL ddH2O

 

         0.5 μL T4 kinase

 

      Heat to 37C for 20 min

 

      Heat to 85C for 5 min

 

 

SET-UP TRAP REACTION

 

Set-up the following 50 μL reaction (this is per reaction so when performing multiply reactions prepare a supermix). Each sample should have a minimum of two conditions:
the sample and the heat inactivated control. You can also set up a dilution series if you are attempting to quantify the activity

 

      Mix:

 

         5 μL 10X buffer

 

         2 μL Primer

 

         2 μL labeled TS primer

 

         1 μL dNTPs (at 2.5 mM each)

 

         0.4 μL Taq

 

         37.6 μL ddH2O

 

         2 μL prepared extract

 

 

RUN REACTION

 

Set up PCR program:

 

      1 cycle

 

30 min at 30C

 

      27 cycles

 

94C for 30 sec

60C for 30 sec

 

 

RUN GEL

      12.5% acrylamide gel (0.4mm) with 0.5X TBE buffer

 

      Add 10 μL of 6X loading dye and run 6 μL

 

      Run gel at about 1000-1200 volts until the first dye runs off and the second dye is about 3/4 the way into the gel

 

 

IMPORTANT BUFFERS:

 

      1X CHAPS (3-[(Cholamidopropyl)dimethylammonio]-1-propanesulfonate) buffer (All Rnase-free)

 

        Mix:

 

      10 mM Tris, pH 7.5

 

      1 mM MgCl2

 

      1 mM EGTA

 

      0.1 mM benzamidine

 

      5 mM 2-mercaptoethanol

 

      0.5% CHAPS

 

      10% glycerol

 

 

        Immediately before lysing cells add 5 mM -mercaptoethanol (stock from Sigma is at 14.3 M so add 0.5 μL to 1.4 mL of the buffer)

 

      10X TRAP BUFFER

 

        Mix:

 

      200 mM Tris, pH 8.3

 

      15 mM MgCl2

 

      630 mM KCl

 

      0.5% Tween 20

 

      10 mM EGTA

 

      0.1% BSA

 

 

      50X dNTPs

 

        2.5 mM of each dNTP

 

 

OLIGOS:
(Oligos ordered purified in solution)

 

 

      ACX: GCGCGGCTTACCCTTACCCTTACCCTAACC

 

      TSNT: AATCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT

 

      NT: ATCGCTTCTCGGCCTTTT

 

      TS: AATCCGTCGAGCAGAGTT

 

 

 

 

CONCENTRATIONS FOR USE:

 

      Primer mix II:

 

         ACX 0.1 μg/sample

 

         NT 0.01 μg/sample

 

         TSNT 0.01 amol/sample

 

 

      Primer mix III:

 

         ACX 0.1 μg/sample

 

         NT 0.1 ng/sample

 

         TSNT 0.01 amol/sample